Red Pastel Hypo Female..anyone heard of one?

WOW, after re reading my explanation, I can understand the head aches inflicted. LOL Borderline manic on second look.

Here's where it was explained to me at Fauna.

http://www.faunaclassifieds.com/foru...ad.php?t=72630

It's better than I can put it, and by smarter people too.

Rick

Originally Posted by crotalusadamanteus

That one goes on the calendar Mark.

OK, lets see if I learned anything here. (Can't blame it on HS, that was 23 years ago )
First understand that Dominant, Codominant and Recessive are describing a relationship between a gene pair at any given locus on a chromosome.

A chromosome is a tightly wound strand of DNA. Although a chromosome is microscopic in size if you unraveled the DNA strand it would be about nine feet long.
Locus is Latin for "place." So, a locus is the physical place on this DNA strand where the individual genes are located.
A gene is a DNA "word" or code made up of four letters...G A T & C. It is a combination of these four letters that make the DNA strand. You can think of DNA as looking like this..
ATCGGCTAGCGTCAGCTAGCTAGGGCTAGGCTTGCTCGATCGTAGCTAGCT and on and on. The code between the bold C's could be a code for a mutant gene...lets say the salmon gene. And the place on this strand of DNA where this gene is at is called its locus.

Originally Posted by crotalusadamanteus

A Salmon hypo is what you would call a visual Het. Meaning, its trait, being Dominant to WT will show up if present, but it is also Het for WT. (Het just means the genes are not identical, but different at that given allele, or locus. Hetero means different) So a Salmon is a Heterozygote. It can pass on a WT, or a Salmon gene. Same with a Salmon to Salmon. They both have a WT gene that they also can pass on. Luck of the draw which gets passed on to who. LOL

WT=Wild type. A WT gene is a normal gene.
An allele is the matching gene located at the same locus on a matching chromosome. You inherit individual chromosomes from each parent. These individual chromosomes are called homolog chromosomes. Homologs combine to form homologous chromosomes. homologous chromosomes contain the same genetic loci in the same order. So, you have two sets of DNA. one from Dad and one from Mom. A allele is the gene on the other stand of DNA located at the same locus of its sister strand.

Originally Posted by crotalusadamanteus

(BTW, Mr. M. Dwight knows this stuff pretty well.

I know a little bit about it.

See what I mean? :

Originally Posted by crotalusadamanteus

See what I mean? :

LOL. I just HAD to give you a little bit of a hard time.
sorry
Happy new year









How did I become such a geek?
Must be in my genes.

Originally Posted by M.Dwight

How did I become such a geek?
Must be in my genes.

what gene would that be G, A, T, or C lol
just kidding

Eric

Originally Posted by ericfire

what gene would that be G, A, T, or C lol
just kidding

Eric

I think I'm only het geek. But I'm pretty sure I'm homozygous super stupid and codominant ugly.

Gaaawd Im glad my brain doesnt download that mess ......
I would be forever trying to understand all that crap.
I some how cant bring myself to a point where all that is important enough to invest my time understanding
Been over 30 years since I was book taught anything,building fast Chevys and working to fund such projects never involved genetics

You should visit those sites I posted Eric. Reading it from different peoples wording helped me out a lot.

That's OK Mark, I probably deserve it anyway. Happy New Year back at you.

Originally Posted by crotalusadamanteus

You should visit those sites I posted Eric. Reading it from different peoples wording helped me out a lot.

I wasn't really trying to teach anything by that post. I was just mess'en with Rick and being a old smart @ss. You can't really learn this stuff on a forum anyway. If your interested in this stuff Eric you need to start with Serpwidgets cornsnake morph guide. It's filled with the right info. Here is the link....

http://cornguide.com/

Hmmm I'm still trying to wrap my miniscule brain around this stuff. I am starting to understand it... taking a while.
Basically, what I got out of it so far is that a co-dom would show traits of both. A Salmon would be concidered a dominant because it is either a salmon or it isn't... there is no het for salmon.
Could someone list some co-doms and some dominants? I pretty much have recessives down... Albino, Anery... stuff like that...
Now a Motley was called a co-dom at one point, but wouldnt that be a dominant also? If i am thinking correctly you breed a Motley to a WT, you get one or the other... so its basically the same in my head... it either is a motley or it isnt.. Thats what my head is trying to sort through... there is a super form of a motley, jsut like there is a Super form of Salmon... you jsut cant tell a salmon as being super or not until you breed... Is that what makes it a dominant rather than a Co-dom? because you CANT tell the difference between the Super and the Salmon?
Also, another thing that has been bugging me... I see adds for "Dominant Ghosts" in adds... If I am correct, a Ghost is a Hypo/Anery mis... If Anry is a Recessive trait, how do you get a Dominant Ghost out of it? Dominant to me is if you breed it to a normal, you will get all or none.. But if the Anery gene is a recessive, how do you get a ghost if bred to a normal?

Ok.... Lost again....