Red Pastel Hypo Female..anyone heard of one?

[crotalusadamanteus]

WOW, after re reading my explanation, I can understand the head aches inflicted. LOL Borderline manic on second look.

Here's where it was explained to me at Fauna.

http://www.faunaclassifieds.com/forums/showthread.php?t=72630

It's better than I can put it, and by smarter people too.

Rick

 

[M.Dwight]

That one goes on the calendar Mark.

OK, lets see if I learned anything here. (Can't blame it on HS, that was 23 years ago )
First understand that Dominant, Codominant and Recessive are describing a relationship between a gene pair at any given locus on a chromosome.

A chromosome is a tightly wound strand of DNA. Although a chromosome is microscopic in size if you unraveled the DNA strand it would be about nine feet long.
Locus is Latin for "place." So, a locus is the physical place on this DNA strand where the individual genes are located.
A gene is a DNA "word" or code made up of four letters...G A T & C. It is a combination of these four letters that make the DNA strand. You can think of DNA as looking like this..
ATCGGCTAGCGTCAGCTAGCTAGGGCTAGGCTTGCTCGATCGTAGCTAGCT and on and on. The code between the bold C's could be a code for a mutant gene...lets say the salmon gene. And the place on this strand of DNA where this gene is at is called its locus.

A Salmon hypo is what you would call a visual Het. Meaning, its trait, being Dominant to WT will show up if present, but it is also Het for WT. (Het just means the genes are not identical, but different at that given allele, or locus. Hetero means different) So a Salmon is a Heterozygote. It can pass on a WT, or a Salmon gene. Same with a Salmon to Salmon. They both have a WT gene that they also can pass on. Luck of the draw which gets passed on to who. LOL

WT=Wild type. A WT gene is a normal gene.
An allele is the matching gene located at the same locus on a matching chromosome. You inherit individual chromosomes from each parent. These individual chromosomes are called homolog chromosomes. Homologs combine to form homologous chromosomes. homologous chromosomes contain the same genetic loci in the same order. So, you have two sets of DNA. one from Dad and one from Mom. A allele is the gene on the other stand of DNA located at the same locus of its sister strand.

(BTW, Mr. M. Dwight knows this stuff pretty well.

I know a little bit about it.

 

[crotalusadamanteus]

See what I mean? :

 

[M.Dwight]

See what I mean? :

LOL. I just HAD to give you a little bit of a hard time.
sorry
Happy new year









How did I become such a geek?
Must be in my genes.

 

[ericfire]

How did I become such a geek?
Must be in my genes.

what gene would that be G, A, T, or C lol
just kidding

Eric

 

[M.Dwight]

what gene would that be G, A, T, or C lol
just kidding

Eric

I think I'm only het geek. But I'm pretty sure I'm homozygous super stupid and codominant ugly.

 

[Metachrosis]

Gaaawd Im glad my brain doesnt download that mess ......
I would be forever trying to understand all that crap.
I some how cant bring myself to a point where all that is important enough to invest my time understanding
Been over 30 years since I was book taught anything,building fast Chevys and working to fund such projects never involved genetics

 

[crotalusadamanteus]

You should visit those sites I posted Eric. Reading it from different peoples wording helped me out a lot.

That's OK Mark, I probably deserve it anyway. Happy New Year back at you.

 

[M.Dwight]

You should visit those sites I posted Eric. Reading it from different peoples wording helped me out a lot.

I wasn't really trying to teach anything by that post. I was just mess'en with Rick and being a old smart @ss. You can't really learn this stuff on a forum anyway. If your interested in this stuff Eric you need to start with Serpwidgets cornsnake morph guide. It's filled with the right info. Here is the link....

http://cornguide.com/

 

[Biscuit71]

Hmmm I'm still trying to wrap my miniscule brain around this stuff. I am starting to understand it... taking a while.
Basically, what I got out of it so far is that a co-dom would show traits of both. A Salmon would be concidered a dominant because it is either a salmon or it isn't... there is no het for salmon.
Could someone list some co-doms and some dominants? I pretty much have recessives down... Albino, Anery... stuff like that...
Now a Motley was called a co-dom at one point, but wouldnt that be a dominant also? If i am thinking correctly you breed a Motley to a WT, you get one or the other... so its basically the same in my head... it either is a motley or it isnt.. Thats what my head is trying to sort through... there is a super form of a motley, jsut like there is a Super form of Salmon... you jsut cant tell a salmon as being super or not until you breed... Is that what makes it a dominant rather than a Co-dom? because you CANT tell the difference between the Super and the Salmon?
Also, another thing that has been bugging me... I see adds for "Dominant Ghosts" in adds... If I am correct, a Ghost is a Hypo/Anery mis... If Anry is a Recessive trait, how do you get a Dominant Ghost out of it? Dominant to me is if you breed it to a normal, you will get all or none.. But if the Anery gene is a recessive, how do you get a ghost if bred to a normal?

Ok.... Lost again....

 

[Biscuit71]

Wouldn't a Salmon or a Motley jsut be concidered "visible hets"? seems like they should be called that... and if the theory about the "eye coloration" in Het Albinos is true... wouldnt that be a visible het also? Because you can tell the difference between normal and het littermates? Very subtle, but possible?

 

[crotalusadamanteus]

Now a Motley was called a co-dom at one point, but wouldnt that be a dominant also? If i am thinking correctly you breed a Motley to a WT, you get one or the other... so its basically the same in my head... it either is a motley or it isnt.. Thats what my head is trying to sort through... there is a super form of a motley, jsut like there is a Super form of Salmon... you jsut cant tell a salmon as being super or not until you breed... Is that what makes it a dominant rather than a Co-dom? because you CANT tell the difference between the Super and the Salmon?

Exactly. They are both Dominant genes to WT, so if present, they both express themselves. (remember, Codominant is still a form of Dominance) But with the Motley gene, you get that outrageous third expression when paired with another Motley, (Super Motley) so it is now proved to be Codominant. Not so with Salmons, making them Dominant.

Also, another thing that has been bugging me... I see adds for "Dominant Ghosts" in adds... If I am correct, a Ghost is a Hypo/Anery mis... If Anry is a Recessive trait, how do you get a Dominant Ghost out of it? Dominant to me is if you breed it to a normal, you will get all or none.. But if the Anery gene is a recessive, how do you get a ghost if bred to a normal?
Ok.... Lost again....

It bugs me too. LOL.
It's the hypo part that they are calling Dominant, (meaning Super or Homozygous). Both parents must have an anery gene and at least one a Hypo gene to make a ghost. But unless proved, it is still just possible homozygous Hypo. Still can't tell on a Ghost either.
And yes, a Ghost is an Anerythristic Hypo. One recessive and one Dominant trait combined. With recessive genes, you CANNOT get results unless both parents pass a gene for that trait. A ghost has 2 Anery genes to pass. (Homozygous, but for a recessive trait this time, like, Albinos too, are homozygous) so they pass ONE gene each for that trait guaranteed. Since it's recessive, it ONLY shows when it is Homozygous. (or paired with another Anery gene) Make any sense?

Wouldn't a Salmon or a Motley jsut be concidered "visible hets"?

Literally, YES. Remember, Heterozygous just means that the genes at a locus are NOT the same. So all Dominant/Codominant traits, unless Super, are literally heterozygous. just not often referred to in that way.

Key words..... Hetero=Different (heterosexual) .......Homo=Same (Homosexual)
These words only pertain to the gene pair being the same, or different at a given locus. Dominant, Codominant, and recessive describe the relationship that happens at that locus. Or something to that effect.


What a way to wake up in the morning. But it worked. I'm definitely awake now.


Rick

 

[ericfire]

You should visit those sites I posted Eric. Reading it from different peoples wording helped me out a lot.

thanks rick
i have been reading the links you provided and also going through some geneology books of my own ,well my wifes i should say im just a somewhat educated firefighter EMT
she is the smart one
the links have helped ,im the type who has to figure out how things tick or ill go nuts
i guess it comes from my parents never telling me to shut up when i asked

(why does that do that or this does this.........you get the picture)

thanks bud

Eric

 

[M.Dwight]

Sorry for butting in.
I would just like to point out that motley is not dominant to WT. If a boa has one motley gene and one WT gene then BOTH of these traits will be expressed in the phenotype.....this makes motley codominant to Wt. If a boa has two copies of the motley gene then motley will be fully expressed.

If a boa has one salmon gene and one WT gene then only salmon will be expressed in the phenotype....this makes salmon a dominant gene.

 

[M.Dwight]

Another way of looking at it.

Lets say you have one boa that is pure black and another that's pure white. If you breed them together and get babies that all have some black pigment and some white pigment then black & white are codominant to each other because the babies are BOTH black and white. Or if the colors combine to form gray boas then you still have a case of codominance because both black and white are being expressed in the phenotype. And this is the what happens when a boa has both motley and Wt genes.

But if breed a black boa to white boa and all the babies are pure black then black is dominant to white....black will be fully expressed in the phenotype. And this is what happens with salmons. Salmon is fully expressed in the phenotype no matter if the boa is het salmon or homozygous salmon. This makes salmon dominant to the WT or normal gene.

If motley was a dominant gene then ALL motleys would look like what we call super motleys.

 

[crotalusadamanteus]

Another way of looking at it.

Lets say you have one boa that is pure black and another that's pure white. If you breed them together and get babies that all have some black pigment and some white pigment then black & white are codominant to each other because the babies are BOTH black and white. Or if the colors combine to form gray boas then you still have a case of codominance because both black and white are being expressed in the phenotype. And this is the what happens when a boa has both motley and Wt genes.

But if breed a black boa to white boa and all the babies are pure black then black is dominant to white....black will be fully expressed in the phenotype. And this is what happens with salmons. Salmon is fully expressed in the phenotype no matter if the boa is het salmon or homozygous salmon. This makes salmon dominant to the WT or normal gene.

If motley was a dominant gene then ALL motleys would look like what we call super motleys.

See, I'm still learning too. But that makes plenty of sense to me. Just that motley patterns look so different to WT never thought about both being expressed.

Thanks for the correction.

 

[Ash Lopez]

The original Hypo boa was discovered by Jeff Gee.Therefore Gee Line Hypo.

The other line was discovered by Rich Ihle.He named his line Salmons.Therfore Salmon boa's.

The RedPastel or any other Pastel is a trait.Not a gene.That is why there are varying degrees of Pastel color on every boa.The pastel trait has a dendency of producing animals that very colorful and clean with very low amounts of black speckling.

When combined with the hypo gene,the results are a very Clean hypo boa with Spectacular Color and very little grey or black speckling.

 

[Paul Kent]

Why does the "super"(dom) form have to be visibly different from the original co-dom form to be considered "super". If there genes are there, what does it matter if its visible or not.

Im by no means an expert, and I hope thats worded right, but if :

Hypo= H
Normal (WT)= N

If a hypo has HN, and a "super" has HH, then what does it matter if you can physically see a difference between the two?

 

[Paul Kent]

Is salmon just a dominant trait? And if so then whats the difference between salmon and super salmon? Is there such thing as super salmon? And if so then how can the salmon trait be simply dominant?

 

[Biscuit71]

I was wondering the same thing.... to me I still don't see the whole thought process of this thread. To me wether it looks like something "different" or not from the co-Dom trait is neither here nor there... if it has all hypo and no normal, and if you breed it to a normal and it proves to be a super, it is a super. If you breed a hypo and a hypo and get normals, it is a co-Dom in my head.... being co-dominant with wild type... thats my thoughts on it... there is either dominant, recessive and co-dominant. Hypo isn't a dominant trait unless it is in its "super" form... but when bred to a normal, it still has a 50% change of producing a hypos... so it would be a co-Dom. You can SEE the effect of the hypo genes, so it is simply a "visual het" of a super form....